About us

CCCCGTGGGGGATAGTCACCGACGCCGTTTTATAGAAGCCTAGGGGAACAGGTTGGTTTAACTAGCTTAAGAAAGTAAATTCTGGGATTATACTGTAGTAATCACTAATTTACGGTGAGGGTTTTATGGCGGATCTTTACAAATTCAAGCCAGGTGATTTCAACAAATTTTGCTGACGATTTAGGCGCACTATCCCCTAAACTACAAATTAGAAAATAGCGTTCCTTGACGGCTAGAATTACCTACCGGCCTCCACCATACCTTCGATATTCGCGCCCACTCTCCCATTAATCCGCACAAGTGGATGTGATGCGATTGCCCGCTAAGATATTCTAACGTGTAACGCAGATGAGTATTCTACAGAGTTGCCGTACGCGTTGAACACTTCACGGATGATAGGAATTTGCGTATAGAGCGTGTCATTGAGGGGTTATACACCCGTAGACTACAACGGGCCCGGCTCAATCAGAACTCGAGTGCCTTGAATAACATACTCATCACTAAACATTCTCAACAGTCAATCGAGCAAGTCCATTATCAACGAGTGTGTTGCAGTTTTATTCTCTCGCCAGCATTGTAATAGGCACTAAAAGAGTGATGATAGTCATGAGTGCTGAGCTAAGACGGCGTCGGTGCATAGCGGACTTTCGGTCAGTCGCAATTCCTCACGAGACCCGTCCTGTTGAGCGTATCACTCTCAATGTACAAGCAACCCGAGAAGGCTGTGCCTGGACTCAACCGGATGCAGGATGGACTCCAGACACGGGGCCACCACTCTTCACACGTAAAGCAAGAACGTCGAGCAGTCATGAAAGTCTTAGTACCGCACGTGCCATCTTACTGCGAATATTGCCTGAAGCTGTACCGTTATTGGGGGGCAAAGATGAAGTTCTCCTCTTTTCATAATTGTACTGACGACAGCCGTGTTCCCGGTTTCTTCAGAGGTTAAAGAATAAGGGCTTATTGTAGGCAGAGGGACGCCCTTTTAGTGGCTGGCGTTCCCCGTGGGGGATAGTCACCGACGCCGTTTTATAGAAGCCTAGGGGAACAGGTTGGTTTAACTAGCTTAAGAAAGTAAATTCTGGGATTATACTGTAGTAATCACTAATTTACGGTGAGGGTTTTATGGCGGATCTTTACAAATTCAAGCCAGGTGATTTCAACAAATTTTGCTGACGATTTAGGCGCACTATCCCCTAAACTACAAATTAGAAAATAGCGTTCCTTGACGGCTAGAATTACCTACCGGCCTCCACCATACCTTCGATATTCGCGCCCACTCTCCCATTAATCCGCACAAGTGGATGTGATGCGATTGCCCGCTAAGATATTCTAACGTGTAACGCAGATGAGTATTCTACAGAGTTGCCGTACGCGTTGAACACTTCACGGATGATAGGAATTTGCGTATAGAGCGTGTCATTGAGGGGTTATACACCCGTAGACTACAACGGGCCCGGCTCAATCAGAACTCGAGTGCCTTGAATAACATACTCATCACTAAACATTCTCAACAGTCAATCGAGCAAGTCCATTATCAACGAGTGTGTTGCAGTTTTATTCTCTCGCCAGCATTGTAATAGGCACTAAAAGAG CCCCGTGGGGGATAGTCACCGACGCCGTTTTATAGAAGCCTAGGGGAACAGGTTGGTTTAACTAGCTTAAGAAAGTAAATTCTGGGATTATACTGTAGTAATCACTAATTTACGGTGAGGGTTTTATGGCGGATCTTTACAAATTCAAGCCAGGTGATTTCAACAAATTTTGCTGACGATTTAGGCGCACTATCCCCTAAACTACAAATTAGAAAATAGCGTTCCTTGACGGCTAGAATTACCTACCGGCCTCCACCATACCTTCGATATTCGCGCCCACTCTCCCATTAATCCGCACAAGTGGATGTGATGCGATTGCCCGCTAAGATATTCTAACGTGTAACGCAGATGAGTATTCTACAGAGTTGCCGTACGCGTTGAACACTTCACGGATGATAGGAATTTGCGTATAGAGCGTGTCATTGAGGGGTTATACACCCGTAGACTACAACGGGCCCGGCTCAATCAGAACTCGAGTGCCTTGAATAACATACTCATCACTAAACATTCTCAACAGTCAATCGAGCAAGTCCATTATCAACGAGTGTGTTGCAGTTTTATTCTCTCGCCAGCATTGTAATAGGCACTAAAAGAGTGATGATAGTCATGAGTGCTGAGCTAAGACGGCGTCGGTGCATAGCGGACTTTCGGTCAGTCGCAATTCCTCACGAGACCCGTCCTGTTGAGCGTATCACTCTCAATGTACAAGCAACCCGAGAAGGCTGTGCCTGGACTCAACCGGATGCAGGATGGACTCCAGACACGGGGCCACCACTCTTCACACGTAAAGCAAGAACGTCGAGCAGTCATGAAAGTCTTAGTACCGCACGTGCCATCTTACTGCGAATATTGCCTGAAGCTGTACCGTTATTGGGGGGCAAAGATGAAGTTCTCCTCTTTTCATAATTGTACTGACGACAGCCGTGTTCCCGGTTTCTTCAGAGGTTAAAGAATAAGGGCTTATTGTAGGCAGAGGGACGCCCTTTTAGTGGCTGGCGTTCCCCGTGGGGGATAGTCACCGACGCCGTTTTATAGAAGCCTAGGGGAACAGGTTGGTTTAACTAGCTTAAGAAAGTAAATTCTGGGATTATACTGTAGTAATCACTAATTTACGGTGAGGGTTTTATGGCGGATCTTTACAAATTCAAGCCAGGTGATTTCAACAAATTTTGCTGACGATTTAGGCGCACTATCCCCTAAACTACAAATTAGAAAATAGCGTTCCTTGACGGCTAGAATTACCTACCGGCCTCCACCATACCTTCGATATTCGCGCCCACTCTCCCATTAATCCGCACAAGTGGATGTGATGCGATTGCCCGCTAAGATATTCTAACGTGTAACGCAGATGAGTATTCTACAGAGTTGCCGTACGCGTTGAACACTTCACGGATGATAGGAATTTGCGTATAGAGCGTGTCATTGAGGGGTTATACACCCGTAGACTACAACGGGCCCGGCTCAATCAGAACTCGAGTGCCTTGAATAACATACTCATCACTAAACATTCTCAACAGTCAATCGAGCAAGTCCATTATCAACGAGTGTGTTGCAGTTTTATTCTCTCGCCAGCATTGTAATAGGCACTAAAAGAG

Our story

Our mission is to save lives through early detection, better prevention and more effective cures for all disease, starting with cancer.

Quantgene started in 2015 in a small UC Berkeley Lab under the leadership of Jo Bhakdi. His theory was that most disease can be detected far earlier than it is today by introducing quantitative science and a new level of precision into medical practice. Since then, our team has spent years building the industry’s best team of pioneers and developing the medical intelligence system. Our medical intelligence system combines extreme precision sequencing, software and AI technologies to profile cell-free DNA (cfDNA) fragments with unprecedented depth and precision. In 2016, Quantgene launched its first clinical feasibility trial which continues today with the goal of adding 10,000 patient samples to the system over the next few years. We are determined to build a future where everyone is protected against most diseases through early detection with our innovative technology.

LEADER-SHIP

icon

Johannes Bhakdi

/ Founder & CEO
icon

Stu Brown

/ SVP of Commercial Operations
icon

Toni Peneva

/ VP of Finance
icon

Robert Kunze

/ Managing Director, Quantgene Deutschland
icon

Fred Hulls

/ Director of Communications

Medi-cal Team

icon

Jonathan Richina, MD

/ Medical Director
icon

Honey Nagakura

/ Director of Genetic Counseling & Genomic Services

The latest news

We envision a future of medicine where all disease is prevented or detected at the earliest stage.

icon
On October 5, Quantgene hosted a delegation of healthcare executives and scientific leaders from Baden-Württemberg at its headquarters in Santa Monica. The group was part of a delegation that included Winfried Kretschmann, Minister-President of the State of Baden-Wurttemberg, Petra Olschowski, State Secretary at the Ministry of Science, Research, and the Arts, Dr. Christian Herzog, CEO of Baden-Württemberg International, as well as political and business leaders from the region. The visit was part of Santa Monica Global, the Santa Monica Chamber of Commerce’s international business networking program which connects local companies making advancements in AI and technology with executives from Germany.
Read more

Join Our Team

We insist on equitable practices not just because it’s the right thing to do, but because fair processes allow our team members to bring their whole selves to work.

We value and include underrepresented communities at all levels of our company. We do the work required to ensure that our culture is as diverse and inclusive as it is collaborative and driven.

We leverage our differences to build the most innovative products in the world and our shared mission to accelerate the world’s transition to sustainable energy unites us in our commitment to creating a future that is good for all humanity

Clinical & Laboratory
Dev Team
Legal
Operations
People & Talent

Why we do what we do

There is a ton of opportunities for career growth here. But most importantly the mission to save lives through early disease detection and better prevention starting with cancer is an easy mission to get behind.

Farrah, Recuiter

Working on products that have the potential to save lives is a special kind of career opportunity. Getting to do it with this team is a real pleasure.

Zach Glass, Head of Growth Marketing